Отиди на
Форум "Наука"

The Genomic History Of Southeastern Europe


Recommended Posts

  • Потребител

Най-накрая излезе проучване и за нашия регион - http://biorxiv.org/content/early/2017/05/09/135616

Изследването е интересно. Ето и част от резултатите (от територията на България):

4725-4605 calBCE Ivanovo Mt -N1b2 Y - G2a2b2a1a1c1a
4711-4530 calBCE Varna Y- G2a2b2b
4685-4499 calBCE Varna Y- G2
4683-4406 calBCE Varna Y- CT
4551-4374 calBCE Varna Y- R1
4550-4455 calBCE Smyadovo Mt- HV15 Y - R
4545-4450 calBCE Smyadovo Mt- K1a26 Y - R1b1a
4450-4264 calBCE Sushina Mt -K1 Y - CT
3400-1600 BCE Beli Breyag Y- I2a2
3400-1600 BCE Beli Breyag Y - I
3338-3025 calBCE Smyadovo Mt- U1a1  Y-I2a2a1b
3336-3028 calBCE Dzhulyunitsa Mt- H Y - H2
3328-3015 calBCE Smyadovo Mt- K1c1 Y- I2a2a1b1
3020-2895 calBCE Merichleri, Mt -T2f Y- I2a2a1b1b
3012-2900 calBCE Mednikarovo Y- I2a2a1b1b
2906-2710 calBCE Dzhulyunitsa Mt - H4a1 Y- G2a2a1a2
1750-1625 calBCE Merichleri, Mt - U5a2 Y - R1a1a1b2

 

Това пък са от територията на Сърбия:

9500-6200 BCE Padina Serbia R1b1a(xR1b1a1a,xR1b1a1a2)
9221-8548 calBCE Padina Serbia R1b1a(xR1b1a1a,xR1b1a1a2)
8753–8351 calBCE Padina Serbia I2a1
8703–8246 calBCE Padina Serbia R1b1a(xR1b1a1a,xR1b1a1a2)
8240-7940 calBCE Vlasac Serbia I
7300-6000 BCE Hadučka Vodenica Serbia I2a2
7300-6000 BCE Hadučka Vodenica Serbia R1b1a(xR1b1a1,xR1b1a1a,xR1b1a1a2)
7100-5900 BCE Vlasac Serbia R1b1a(xR1b1a1a,xR1b1a1a2)
6655-6225 calBCE Vlasac Serbia I2
6500-6250 calBCE Vlasac Serbia I
6355-5990 calBCE Hadučka Vodenica Serbia I2a2a1b2
6222-5912 calBCE Lepenski Vir Serbia R1b1a
6200-5900 BCE Vlasac Serbia I2a2a1b
6200-5900 BCE Vlasac Serbia I2a2a
6200-5900 BCE Vlasac Serbia I2a2a1b2
6200-5900 BCE Vlasac Serbia I2a2a1b2
6061-5841 calBCE Padina Serbia R1b1a(xR1b1a1a,xR1b1a1a2)
5604-5376 calBCE Gomolava, Hrtkovci, Vojvodina Serbia G2a2a1
4710-4504 calBCE Gomolava, Hrtkovci, Vojvodina Serbia G2a2a1a
4605-4460 calBCE Gomolava, Hrtkovci, Vojvodina Serbia G2a2a1a
 
А това е автозомната картина:
 
Auto.thumb.png.f4544754e7349a14bdb3f693524c0ef6.png
 
 
Link to comment
Share on other sites

  • Мнения 70
  • Създадено
  • Последно мнение

ПОТРЕБИТЕЛИ С НАЙ-МНОГО ОТГОВОРИ

  • Глобален Модератор

Някакво резюме на резултатите като за неспециалисти?

Link to comment
Share on other sites

  • Потребител

На първо четене,резултатите разрушават митовете за енеолитните земеделци. Май няма много влияние от Азия. Трябва да се преосмисли основно теорията за земеделието в Европа и кой какво е донесъл и измислил. Не виждам Азиатско влияние. Ама хич.

Link to comment
Share on other sites

  • Потребител

Е хаплогрупа G не е ли азиатска?

Link to comment
Share on other sites

  • Потребител
Преди 9 часа, stinka (Rom) said:

Е хаплогрупа G не е ли азиатска?

Кавказка, има разлика. Гледам че, на други места има Е а тук не,това е , странно.

Редактирано от bulgaroid
Link to comment
Share on other sites

  • Потребител
1 hour ago, bulgaroid said:

Кавказка, има разлика. Гледам че, на други места има Е а тук не,това е , странно.

Кавказките са G2a1 , а тук имаме G2a2

Haplogroup G2a1 and its subclades represent the majority of haplogroup G samples in some parts of the Caucasus Mountains area. They are found only in tiny numbers elsewhere. So far all G2a1 persons have a value of 10 at STR marker DYS392. G2a1a persons also typically have higher values for DYS385b, such as 16, 17 or 18, than seen in most G persons.

Ashkenazi Jewish G2a1a men with northeastern European ancestry form a distinct cluster based on STR marker values. Men from the Caucasus and men from eastern Europe also form distinctive STR clusters.

The G2a2a subclade (M286) is tiny. Samples indicating British Isles, Turkish and Lebanese ancestry have been identified. The British samples have inconsistent double values for STR marker DYS19 in many cases. M286 was first identified at Stanford University at chromosome position 21151187, and is a mutation from G to A.

G2a2b (G-L91) was identified in 2009. Its members include "Ötzi", the so-called Iceman, who died at least 5,000 years BP in the European Alps. G2a2b would seem to encompass a significant proportion of men belonging to G. L91 is found so far in scattered parts of Europe and North Africa and in Armenia. Included within G2a2b are some men with double values for STR marker DYS19, but there are also G2a2 men with this finding who are not G2a2b. The double 19 value situation is not seen in the G2a1 and G2a3 subclades. The L91 mutation is found at 21327383 and rs35474563 on the Y-chromosome. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. The mutation involves a change from C to T.[16] L223 is found on the Y chromosome at rs13304806.

 

Вижда се, че това са различни големи клонове на G, които в различно време мигрират в различни посоки и имат различно генетично развитие. Има отделен клон в Испания, Италия и т.н.

The G2a3b1 definable subclades are heavily concentrated throughout Europe west of the Black Sea and Russia where G2a3b1 is often in the majority among G persons. Small percentages of G2a3b1 are found primarily in the area encompassed by Turkey, the Caucasus countries, Iran and the Middle East where the G2a3b1 SNP may have originated. G2a3b1 is also found in India. The great majority of P303+ men belong to one of its subclades.

 

Link to comment
Share on other sites

  • Потребител

Да това не го погледнах. Така е G2a2 е азиатско, което навява на мисълта, изтласкване на най-древните земеделци от Азия и Европа и последващото им унищожение даже в Европа. Незнам има ли в съвременна България тази хаплогрупа, и не ми се рови.Тук преобладава N и I2. Много е интересен случая с Варна. Погледнах имаме, спор, може и да е Кавказка, с разпространение в Азия. Но има разпространение на Сардиния също.

Редактирано от bulgaroid
Link to comment
Share on other sites

  • Потребител
Преди 12 часа, Atom said:

3328-3015 calBCE Smyadovo Mt- K1c1 Y- I2a2a1b1
3020-2895 calBCE Merichleri, Mt -T2f Y- I2a2a1b1b
3012-2900 calBCE Mednikarovo Y- I2a2a1b1b

I2a2a1 (M284+)

I2-M284 occurs almost exclusively in Britain and Ireland, but has also been found in Portugal, France, Germany and Norway. It is a very old haplogroup, originating some 10,000 years ago and is split in two subclades Y10626 and L1195, which are each about 7,000 years old. Present-day carriers share a common ancestor who lived approximately 5,500 to 6,000 years ago, during the Megalithic age.

http://www.eupedia.com/europe/Haplogroup_I2_Y-DNA.shtml

Редактирано от Пандора
Link to comment
Share on other sites

  • Потребител
Преди 12 часа, Atom said:

4545-4450 calBCE Smyadovo Mt- K1a26 Y - R1b1a

The homeland of R1b1a (P297) and Pre-Proto-Indo-European speakers is presumed to have been situated in eastern Anatolia and/or the North Caucasus. The Caucasus itself is a hotspot of haplogroup G. Therefore, it is entirely conceivable that a minority of Caucasian men belonging to haplogroup G (and perhaps also J2b) integrated the R1b community that crossed the Caucasus and established themselves on the northern and eastern shores of the Black Sea sometime between 7,000 and 4,500 BCE.

Link to comment
Share on other sites

  • Потребител

Това което бие на очи най-много е липсата на приемственост по  Y-dna между древните и съвременни обитатели на балканите. Т.е. мъжкото население периодично е подменяно. От хартията може да се направи извод, че най-вероятно съвременните балканци са наследници на пришълци от последните 3000 години. По-ранните популации са оставили (ако изобщо са оставили) незначителни следи в генетичния фонд на мъжката половина от сегашното население на балканите.

Картината ще се избистри едва когато се проучи материал от по-ново време - късния бронз, желязо, античност  и средновековие. 

Link to comment
Share on other sites

  • Потребител
Преди 53 минути, Last roman said:

дам, дотук бяха автохтонните митове за българи=траки=атланти...

Ами не това са много по-древни времена, та,още действат.

Link to comment
Share on other sites

  • Глобален Модератор

то автохтонните нелепици почват от най-древни врремена - варненското съкровище, пеласги и пр...

Link to comment
Share on other sites

  • Потребител

И така - в Сърбия и България няма нещо по-специално, но три проби от Хърватия заслужават внимание.

Първата е I3948, Croatia_Cardial_Neolithic - Zemunica Cave. Това е E1b1 (E1b1b1a1b1). Датирана е 5600-5470 BCE и е от южна Далмация. Досега не беше много ясно от къде "E" навлиза в Европа. Първоначално се приемаше, че навлиза с неолитчиците. В древните неолитни култури обаче се откриват почти винаги само G2a. Досега имаше само две древни проби "Е" - една от Испания и една в Унгария. Третата проба - тази в Хърватия е най-старата и е открита в среда, подобна на испанската. Сега нещата се изясняват и спокойно може да се потвърди една от хипотезите, че Е навлиза с т.н. "средиземноморски неолитчици" - носителите на културата Cardium pottery, които културно се различават доста от основната неолитна вълна. Ето карта на разпространението на тази култура:

Cardial_map.thumb.jpg.3785b71ff7689a96a3533d9c9b7c3b4f.jpg

 

 

Следващата проба която заслужава внимание е I3499, Croatia_Vucedol, Beli Manastir-Popova zemlja. Датирана е 2884-2666 BCE. Пробата е R1b1a1a2a2. Това е основната група на културата Ямна.

Третата проба е I4331, Croatia_EMBA, Veliki Vanik. Пробата е J2b или по-точно J2b2a. Това е бронзова епоха - южна Далмация, 1700-1500 BCE .

Защо тези проби са интересни? Защото и трите групи са характерни за балканите и тук е нещо като гореща точка за тях. В България около 20% от мъжкото население е E1b1, 5% е точно от този подтип на R1b и около 3,8% от J2b2a.

Редактирано от Atom
Link to comment
Share on other sites

  • Модератор антропология

Привет, изследването е прекрасно. Препоствам от ФБ, историята на балканите е невероятна. 

18557367_1324396227638173_87801980598231

18664392_1324419657635830_91440015526293

Геномът на българската народност е съществено непроменен от бронзовата епоха насам. Това е учудващия извод от The genomic history of Southeastern Europe (Mathieson et al. 2017 preprint) - изследване, покриващо над 200 антични генома от бронзовата и неолитната епоха от България и Балканите. Съвременният български народ придобива окончателната си физиономия по време на бронзовата епоха - на балканите. Много малко се е променило от бронзовата епоха (3000 г.пр.н.е.) насам, все едно нашествията на славяни и прабългари изобщо не са се случили. Възможните обяснения са две - или тези нашествия наистина не са се случили, или по-вероятно, геномът на нашествениците славяни и прабългари не се различава по същество от генома на завареното население. Каквито и да са причините, българският народ търпи малка промяна от балканската популация отпреди 4000 г. Да не кажа никаква. Но това е само повърхността на изследването. Дрги любопитни новини - миграцията на протоиндоевропейците от Ямная на балканите започва още преди 6000 г , 2000 г. по рано от останалите индоевропейски миграции. А че е от Ямная в понтийската степ, няма съмнение. Тука идва първата съществена изненада. Секвенсирани са геномите от неолитния некропол край варна (на-старото злато на света и т.н.). 3-ма от 5-мата индивида са наполовина от Ямная. Хаплогрупата на единия е R1a....Хаплогрупата на другия е -I2a. По-важното, до 50%от аутозомното им днк принадлежи на протоиндоевропейската култура от Ямная. Останалите скелети от некропола обаче са с изцяло фермерско днк, а хаплогрупата на вожда е СТ - не се среща в наши дни в европа. Варненската култура изглежда като синтез на протоиндоевропейци от Ямна и балкански неолитни фермери, като в ролята на шеф-а са фермерите - на тях принадлежат по-скъпите погребения. Можем да спекулираме, че индоевропейците от ямна са в ролята на наемни войници във Варна, подобно на митаните няколко хилядолетия по-късно. Балканите по време на късния неолит са мозайка от гени. Неолитното селище от малък преславец се състои от фермери със смесен произход - 75% балкански фермери и 25% балкански ловци събирачи (които са същите като западноевропейските). И отново намираме известен индоевропейски примес от ямна - един от фермерите е от хаплогрупа R1B. От 3000 г.пр.н.е нататък, всички индивиди носят степно наследство от ямна. То е определена пропорция, около 25-30% от общото днк; за сравнение, в северноевропейската бойна брадва пропорцията е 50%, в Бел Бийкър,която завладява или се настанява в Иберия и Британия -а може би и в италия, процентът е 40%. На балканите отсъства тоя тип завоевание и подмяна, каквато виждаме в останалата част на европа. Причината е вероятно в предишната индоевропейска вълна, поради която е възможно балканите вече да говорят на индоевропейски език - нищо, че са фермери. Но на какъв език? 1f642.png:) освен това балканските фермери са богати и умеят да строят крепости;а, и вероятно - имат индоевропейски наемници за войници. Каквато и да е причината, навлизане на индоевропейски гени има, има следи от големи войни и кървави драми - но тук новодошлите индоевропейци са първи между равни, а не завоеватели, които екстерминират всичко по пътя си. Около 1600 г. пр. н.е. има нова вълна от индоевропейски гени - съвпадението с появата на микенска гърция и тракийските племена не е случайно; новодошлите отново носят гени и хаплогрупи от Ямная; но отново, вместо пълно изтребление на заварените, имаме синтез на народи. За мен остава отворен въпросът кои са носителите на древногръцкия език и тракийския - защото има вероятност новодошлите микенски и тракийски племена да са възприели езиците на заварените от тях балканци, подобно на митаните в мала азия, които проговарят хуритски, на хетите пак там, които възприемат името на победения от тях народ и на викинги и прабългари от много по-късни епохи, които охотно възприемат езици и култури на по-напреднали или по-многобройни от тях народи и се вписват като техни елити. На Балканите има три индоевропейски вълни. Всяка от тях заварва високи култури,умеещи да се бранят и се вписва в тях. Но, обърнете внимание на графиката. След 3-те вълни, последната от тях 1500 г. пр. н.е., демографски промени на балканите и по-специално в България повече няма, което е учудващо. Историята е по-странна от измислица.

Link to comment
Share on other sites

  • Потребител
Преди 4 часа, Южняк said:

Привет, изследването е прекрасно. Препоствам от ФБ, историята на балканите е невероятна.

Радвам се, че пак си тук, Южняк!

http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0177127

Това е от днес.

Link to comment
Share on other sites

  • Модератор История
On 5/12/2017 at 12:24, Atom said:

Това което бие на очи най-много е липсата на приемственост по  Y-dna между древните и съвременни обитатели на балканите. Т.е. мъжкото население периодично е подменяно. От хартията може да се направи извод, че най-вероятно съвременните балканци са наследници на пришълци от последните 3000 години. По-ранните популации са оставили (ако изобщо са оставили) незначителни следи в генетичния фонд на мъжката половина от сегашното население на балканите.

Картината ще се избистри едва когато се проучи материал от по-ново време - късния бронз, желязо, античност  и средновековие. 

Южняк, моля те коментирай това?

Link to comment
Share on other sites

  • Модератор антропология

Thorn, ами това Атом да си го коментира, постинга е негов, макар че се досещам какво има предвид. Аз ще коментирам чудесната ти тема за троянската война:

"Само, че тогавашните герои (хероси), са били всичко друго освен алтруисти. Те са нещо като юнаци, нещо като бабаити, но най-вече напомнят героите на скандинавските саги. Необуздани откачалки, постоянно заети в разбойнически походи по суша и море. Мутри без задръжки, избухливи и гневливи. Повечето са забъркани в убийства и на роднини, примерно същия Пелей убил брат си просто от завист. Абе доста неприятни типове, живеещи във време, когато силата е право, а справедливостта е донякъде авангардна религиозна концепция.

По-удачните от тях поулягат с възрастта, стават водачи на банди или дружини, воюват повече или по-малко успешно, могат и да станат владетели на някое царство, обикновено доста микроскопично, но и там много не се заседяват. Рядко успяват да предадат властта си по наследство." - чудесен постинг. От доста време се знае, че омировия епос е пълен с анахронизми от по-стари времена. Самата история е до голяма степен анахронизъм - вероятно, от времената на войните на дошлите от степъта микенци, които основателно сравняваш с викингите. Подсказка за това е примерно човешкото жертвоприношение, което споменаваш - на Ифигения; Микенската епоха я наричат епохата на цитаделите. Микенските царе са непрекъснато воюващи царе пирати, които живеят от плячкосване и плячка. Тая епоха - на завладяването на балканите - е отразена в Омировия епос; героите са примитивни и брутални - лаерт, след като убива врага си, му пие мозъка. Хетите и египтяните имат непрекъснати проблеми с "ахейците", данайците" и "аргийците" - забележи, в илиадата няма "елини". Има международна конфедерация от бандити, които се занимават с пиратство. Геномите на тези бандити са секвенскирани от изследването. От един момент нататък всичките са със степно наследство, но това не е наследството на Бел Бийкър или Бойна брадва - ако говорим за 15 в. пр. н.е., в самата степ и на балканите играта е различна, става въпрос за конфедерации и индивиди от на-разнообразен етнически бакграунд, приемани меритократично. Конфедерацията на ахейците и данайците е подобна на хиксосите от същото време и на митаните пак от същото време - крале (хероси)-разбоници, които атакуват богатите градове от медитеранието. Но те не са етнически хомогенни - именно това разкрива изследването. Така, както измежду митаните има хурити, при хиксосите има смесици от индоевропейски, семитски и хуритскиимена, при ахейците и данайците има негръцки субстрат от международдни авантюристи, които ги обединява мечтата да оберат няко град и умението да карат бойна колесница.

Ако се върнем на Омир, епитетите му за пеласгите, съюзници на троя, са "божествените пеласги", "богоравните пеласги"; доиндоевропейското население на крит също се споменава с огромно уважение ("етеокретанс"), "истинските", "старите" критяни (за разлика от нашествениците) и Омир не пести комплименти за бойните им умения. Страбон и Херодот споменават за "пеласги" говорещи негръцки език до 2-ри век пр. н. е. на лемнос примерно (херодот до 5-ти) и говорят за тях с уважение. Друг е въпроса за езика на тези пеласги -според една много талантлива българска лингвистка, гръцкото пиргос е заемка от бург, т.е. в гръцкия има негръцки -но също индоевропейски езиков субстрат.

Микенците завладяват миноския крит но не го унищожават - напротив, те прописват на линеар Б, писмеността на минойците, т.е. има респект, донякъде културен континуитет, така, както вандали и германци се възхищават на рим и искат да са римляни, въпреки че са го завладели и учат латински няколко хилядолетия по-късно.

Индоевропейските воини от Варна, идентифицирани от изследването, са първите степни хероси. Микенското завладяване е края на историята, започнала 2000 години по-рано. Но в нито един момент няма това пълно генетично заместване, което наблюдаваме в западна и централна европа. На всичкото отгоре, през последвалата желязна епоха, индоевропейското днк на балканите *намалява*! - в образеца от класическата епоха от 5 в. пр. н.е. (трак?) - индоевропейския компонент е значително по-малък, отколкото у херосите от предходната бронзова епоха; тоест, популацията от индоевропейци на балканите не нараства - тя се топи, а нараства старата фермерска популация. Накрая винаги печелят селяните, както каза един геро на куросава. Войниците са избити в хилядолетия на войни с цел плячка. Тука е и ключа за бараката с отсъстващото прабългарско и славянско днк у съвременните българи - то е тука, не е отсъстващо, но компенсира намалялото степно днк през желязната епоха и връща пропорциите до предходната бронзова епоха, поради което днешните българи са неразличими от тези от бронзовата епоха.

Дисконтинуитет има, да, но между неолитна и бронзова епоха - и то не е тоя пълен дисконтинуитет, кото наблюдаваме в западна европа. Половината образци от късния неолит са от I2a, която и до днес е на-честата хаплогрупа в България. Но, по-важна е историята, която разказва аутозомното днк.

Link to comment
Share on other sites

  • Модератор антропология

Така, ами прабългарите? След това изследване, твърдението, че прабългарите са "тюрки", е пълна смешка. Те може и да са говирили и на папуаски, но това са степни групи от причерноморската степ, неразличими от индоевропейците от бронзовата епоха, които не са и помирисвали азия отвъд урал, да не говорим за алтай - пълен абсурд. Този народ се е оформил в понтийската степ, иначе съвременните българи нямаше да сме неразличими от балканците от бронзовата епоха. Прародината на протобългарите е кавказ и понтийската степ. Преди мислех, че поради прабългарите съвременните българи са отклонени по посока кавказ - само че, това отклонение може да бъде видяно още у балканците  от бронзовата епоха, хиляди години преди прабългарите, в същата степен като сега, поради което очевидно се дължи на много по-стари събития. Като се има предвид кои са живели в късната античност и ранното средновековие в понтиската степ, прабългарите вероятно са синтез на останки от сарматски и сарматоирански племена, респективно, напълно неразличими от индоевропейските балкански популации - което съм подозирал от много време. Който си въобразява, че у прабългарите е имало някакъв тюрко-монголски компонент, да погледне графиките - където сме били преди 3500 години, там сме и сега. 

Втория извод - тая мистериозна връзка между съвременни българи и северноиталианци също съществува още от бронзовата епоха и не е никак нова - нито е свързана със славяни и прабългари.

И нещо куриозно - 2 от обраците, погрешно вземани за хора от белл бикър, се оказаха погрешно датирани и са на славяни от 5 век сл. н.е. от Чехия, така че имаме и първото цетифицирано славянско днк отпреди разселението на славяните, макар и добито по погрешка, което обаче го прави още по-ценно, защото изключва пристрастността:Czech_early_Slav_RISE569.png

И..а, изненада - античните славяни са с по-южно днк от това на съвременните източни и централни славяни и са по-близо до нас, отколкото, примерно, до руснаците (горе-долу по средата между съвременни българи и съвременни руснаци). Т.е. като бонус, получаваме потвърждение на това, че славяните не са особено различни от траките и далеч не са някакви нордическо-скандинавски европейци - съвременните руснаци и поляци са получили изглежда солидни дози скандинавски и фински гени, а може и германски, които отсъстват до голяма степен у античните славяни. Това е и подсказка защо у българите славянското днк се припокрива с това от бронзовата епоха. 

 

Link to comment
Share on other sites

  • Модератор История

Имах предвид да коментираш тезата за липса на приемственост по Y-dna.  Това означава ли, че (силно опростено) неколкократно Балканите са подлагани на катастрофални нашествия, в които нашествениците са избивали местните мъже и са вземали местните жени?

Другото интересно - не ми стана много ясно за прехода между халколита и ранния бронз. По-точно - в самия край на 5 хил. пр. н. е. тази култура загива, като селищата са разрушени от нашественици. Традиционно това се интерпретира като ранно индоевропейско нашествие. Означават ли резултатите, че фактически местното население не е избито, макар и протоцивилизацията му да е унищожена? И тогава ли е едната замяна на Y-dna? Т. е. да са избити мъжете?

Колкото за ахейците, прабългарите и славяните, това което пишеш, не противоречи особено на историческите сведения.

Примерно за ахейците, разнообразният им произход и да не е акцентиран специално, той си върви между другото. Кадъм основателят на Тива е финикиец, Агамемнон и Менелай са от Мала Азия, а разшифрованите плочки линеар Б от (Пилос особено) говорят за впечатяващ брой анатолийски робини. 

За прабългарите, като генетична общност-наследник на сармато-алански причерноморски племена няма нищо невероятно. Но това по никакъв начин не отрича наличие на някакво прослойка, възможно аристократичен елит с произход различен (поне отначало) от останалите. Т. е. условни "прабългари", условно произлизащи от Бактрия, Согдиана, Минусинската котловина или откъдето там по Средна Азия излизат някакви "следи". Т.е . азиатски "българи" властващи над местни "сармати". При това те бихо могли в доста кратък срок да се смесят с местните на ниво биология, което да не им пречи да имат различен език, култура и самосъзнание, което е същественото за историята. Забележи - аз това не го твърдя, само не го отхвърлям като възможност.

Ще дам исторически аналогии. Преобладаващото население на Златната орда е местно източно европейско. Но самата тя се образува в резултат на монголско завоевание, аристокрацията е от монголски произход (Чингисиди) и това да си потомък на монголци е било много важно дори векове след това. Примерно Гиреите мотивират властта си над Крим с това до края на 18 век. А и самият монголски език е употребяван поне до края на 14 век, т. е. поне 150 години след завоеванието. Обаче ако не знаем това, масовите гробове при разкопки ще си показват местни гени и тезата за източно завоевание ще се счита за съмнителна. Идеята ми е, че една чужда по произход прослойка може и да относителна малобройна, дотолкова, че трудно въобще да се засича при анализ на археологична ДНК, но историческата и роля и влияние да бъдат абсолютно непропорционални на числеността и.

Подобно е положението и в Галия. Германските завоеватели -франки са малко, под 15%, но далеч повече във висшата аристокрация. Обаче дори 400 години след завоеванието във ладетелския двор се говори немски.

Славянските завоевания. Продължили са около 200 години. Обичайно описание - славяните дойдоха, превзеха крепостта, отвлякоха населението. И после - славяните освобождават робите си и те почват да живеят при тях като свободни хора. Вероятно още през първите 50 години мнозинството от "славянските" завоеватели са били потомци именно на това отвлечено население. Но говорещи славянски, със славянско самосъзнание, религия, култура и т. н.

Link to comment
Share on other sites

  • Модератор антропология

Thorn, ти много сериозни въпроси поставяш. Не съм този, кото да им отговори, ако някой изобщо би могъл в наши дни. Но бих опитал при първа възможност, тези дни.

Сравни ситуацията на балканите с тази в останала европа - в англия, според изследването пак отпреди около месец на днк от бронзовата епоха, при навлизане на индоевропеците от бел бикър е подменено 93% от населението в рамките на буквално еднократно нахлуване. Тотален геноцид. Ситуацията в централна и западна европа е много, много близка. На балканите е различно - инфилтрирането на групи от ямная продължава повече от 2 хилядолетия. Няма завоевание. Има - предполагаемо - стотици войни от типа на троянската. Фермерите се отказват от фермерството. Балканите са бойно поле за няколко хиляди години, където мерят сили както фермерски групи, така и разнообразни групи от ямна. Форпостовете на ямна са съвсем наблизо - от изследването се оказа, че най западния хоризонт на ямна е в българската добруджа - т.е. това е част от коровата, базовата протоиндоевропеска територия на ямна. А варна и северна българия са съвсем наблизо, те са гранични на ямна. Може би поради това отсъства това желание за геноцид. Варна отпреди 5-6 хиляди години е неолитно селище, населено с фермери от хаплогрупа G. Такива са и селищата в южна българия - всичко е G при фермерите, никакъв примес от ямна или от ловците събирачи. В тоя смисъл, преди около 6000 години на балканите започва генетична промяна. В нея активна роля играят и балканските  ловци събирачи от I2. Каква, не е ясно. Има ловни селищаот мезолита с тази хаплогрупа. Но тази хаплогрупа,  I2, се среща и при протоиндоевропейците от ямна, тя е идентифицирана у няколко индивида от ямна. У един ямна индивид има и E3b. У 2 скитски погребения от желязната епоха има J2. Но, разбира се, основнитехаплогрупи са R1a и R1b. Тези хаплогрупи се появяват на в контекста на неолитните селища в България преди 6000 години, вътре, в селищата, специално във варна и малък преславец. Бариерите са разбити между двете култури. Погебваните вождове обаче са все така от Г2, фермерската хаплогрупа, както и основното население. Има нарастване на честотата на I2 от 6000-та година нататък, но тя съществува на балканите и преди това - всички балкански ловци събирачи са от нея, но сега започва да се появява във фермерски контекст, но също и в степен, протоиндоевропейски контекст. Не знам какво става? Ловците и хоратя от ямна имат генетична връзка помежду си, това е сигурно. Дали не са имали и езикова? Но индоевропейското нахлуване на балканите е предимно на хора от I2. Да, I2, обаче в степен контекст, воини на коне и колесници. Не можеш да кажеш кой е балканец по баща и кой от ямна. На всичкото отгоре тези от I2 се вписват и в късните фермерски градове.  Преди 6000 години, по същото време, в Караново фермерите издигат първите крепостни стени. Дебели, ходих да ги видя отпреди месец. Сигурно са имали причина да ги издигнат - най-вероятно, нападенията на херосите от Ямна. Тези стени издържат цели 500 години - това са 5 века успешни отбивания на индоевропейските нападения срещу града в Караново. По същото време, измежду фермерите от неолитните градове има хора с геноми от ямна. Наемни войници? - Твърде вероятно. Или продукт на недоброволно зачеване, защо не и смесени бракове. Но ако едни фермери отстояват атаките на войнствени племена 5 века, те вече не са фермери. Те самите са станали войници. Мисля, преди 5200 години крепостните стени на-накрая са разрушени, градът е унищожен - но - земята не спира да се обработва - фермерите живеят някъде другаде. Миналата година бях в ягодинската пещера в родопите, 150 скелета на неолитни фермери, избити в пещерата, с което се слага край на пещерното селище. Ножовете на нашествениците междуврочем приличаха на тракйските ромпеи, според едно младо момиче, археолог, уредник в селището, те *бяха* тракиски ромпеи, ако е вярно, прототраките са се появили  в родопите евентуално тогава и да, са видели сметката на оттеглилите се в пещери и по егейските острови (тасос) фермери.  Но - два века по-късно крепостните стени в караново отново са издигнати и изкарват чак до 2800-та г. пр. н. е. когато селището загива окончателно. Кои са били заселниците - те имат степна кръв, но тя е от порядъка само на 20%-та, останалата част от днк-то им е местна, балканска, предимно фермерска. Тези 20% са разпределени равномерно, балканите си имат вероятно индоевропейски елит, но той е тежко смесен с местните ловци и фермери. Дало обаче е правилно да ги наричаме ловци и фермери? Те може би говорят индоевропейски език вече и се интересуват от войни и грабежи повече, отколкото от земеделие. Преди 3600 г. има нов скок в индоевропейското днк, то започва да гони 35% - това е микенската епоха. Нови групи са навлезли от степта. Но те не заварват безобидни фермери, а крепости - вкл. троя, населени от хора, които са смесени между индоевропейци и фермери и охотно въртят меча. Поради това заместване на популацията няма. Няма геноцид като в англия и зап. европа - напротив, микенците се опитват да обират градовете, строят кули и крепости, но старите също оцеляват, а микенците попиват и се възхищават и на местната висока култура, и на войнишките качества на новозаварените. Поради културата на войни с цел плячка, вероятно, вместо да се увеличат, от този момент нататък индоевропейските гени започват да намаляват и се наблюдава намаляване на относителния дял на индоевропейското наследство на балканите През желязната епоха то е все по малко, а фермерско-анатолийското наследство расте. Странно, печелят фермерите. Но като четем омировите епоси, не е странно. Сегашните българи отново са с повишено ямна наследство в сравнение с тези от желязната епоха. То е обратно до нивото на хората от бронзовите балкани и микенската епоха. Това евентуално се дължи на последвалите нашествия на готи, славяни и прабългари тук, които носят същите гени и демографски характеристики като микенските завоеватели от бронзовата епоха.

Но щом след индоевропейското завоевание фермерското наследство на балканите расте, вместо да намалява, и фермерите са мнозинство през желязната епоха, това означава, че индоевропейците никога не са взели ясен връх над фермерите тука. Никога не са надделели - напротив, през 2-в. пр.н. е. все още на балканите има племена и места, където се говорят "пеласгийски" езици. Това може би не са фермери, а хора от предишното индоевропейско нахлуване. Но то ни най-малко не е геноцидно, след като ямна примеса преди 3000 г. е само 20% (отново, сравни с 93%-на подмяна) в Англия. Тукашните фермери са по-други още в късния неолит - смесица от фермери, източноевропейски ловци събирачи и авантюристи и наемни войници от ямная. И явно са трудна до невъзможност хапка за преглъщане, която се индоевропеизира, но не изчезва като в зап. европа. 

Но да, от мъжките хаплогрупи отпреди 6500 г има не-повече от 5-6 процента Г2 оцелели. Останалото е по-ново. 

Link to comment
Share on other sites

  • Модератор антропология

У скитите има нещо, подобно на балканските "индоевропейци" - само че при тях това е нарастване на кавказкия компонент с врето, вкл. навлизане на кавказки мъжки хаплогрупи - J2. Подобно е и при индоариите и индоиранците - за първите вече се знае, че са с повече съдържание на кавказко днк от по-ранните ПИЕ миграции. Сега, микенската миграция е късна относително - тя е с окло 1000 г. по-късна от бойна брадва и бел бийкър. Индоевропейците от тази миграция са малко по-различни като днк - по смесени са с кавказките народи. На балканите са може би по смесени и с балкански нативни гени. Това за мене отваря една любопитна възможност - примерно етногенезиса на индоевропейците от източното средиземноморие изобщо да не е осъществен в степта, а на територията на балканите. Няма да се изненадам, ако някоя от тези групи - микенци, ахейци, дорийци, македонци или дори римляни, е с всъщност с етногенезис осъществен не в ямная, а на балканите и по-точно културата варна-караново или добруджанската степ и представлява именно тази смесена популация, началото на която виждаме във варна. Предчувствието ми е, че част от големите цивилизации на античното средиземноморие ще се окажат свързани като етногенезис с хората от варненския некропол или други "горещи" точки от съвр. българия. Чакам с любопитство изследванията.

Link to comment
Share on other sites

  • Глобален Модератор
Преди 3 часа, Южняк said:

Т.е. като бонус, получаваме потвърждение на това, че славяните не са особено различни от траките и далеч не са някакви нордическо-скандинавски европейци - съвременните руснаци и поляци са получили изглежда солидни дози скандинавски и фински гени, а може и германски, които отсъстват до голяма степен у античните славяни. Това е и подсказка защо у българите славянското днк се припокрива с това от бронзовата епоха. 

Ново двайсе! :) Досега всички си мислеха (включително и ние), че сме най-не"чистите" славяни, а изведнъж се оказва точно обратното - че сме най-чистите, поне генетически! :) 

Link to comment
Share on other sites

  • Модератор антропология

Лорде, малко преувеличих, ама съвсем малко - най-точно съвпада с това на съвр. чехи, но в общи линии е по-близо до нас, отколкото до русия или белорусия - все е нещо. Северните славяни изглежда са натурализирали твърде много угрофини покрай експанзията на руската империя. Под твърде много имам предвид нещо от порядъка на 50%.

Link to comment
Share on other sites

  • Модератор История

А кое доказва, че онези погребения са на "славяни"? Имам предвид защо например да не са квади, маркомани, бои и който там е живял в Чехия през 5 век.

Link to comment
Share on other sites

Напиши мнение

Може да публикувате сега и да се регистрирате по-късно. Ако вече имате акаунт, влезте от ТУК , за да публикувате.

Guest
Напиши ново мнение...

×   Pasted as rich text.   Paste as plain text instead

  Only 75 emoji are allowed.

×   Your link has been automatically embedded.   Display as a link instead

×   Your previous content has been restored.   Clear editor

×   You cannot paste images directly. Upload or insert images from URL.

Зареждане...

За нас

Вече 15 години "Форум Наука" е онлайн и поддържа научни, исторически и любопитни дискусии с учени, експерти, любители, учители и ученици.

 

За контакти:

×
×
  • Create New...